Here you can search in all of the data we have in our marine catalogues
*A new integrated search interface will become available in the next phase of marineinfo.org.
For the time being, please use this page as the search interface.
Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains Citation Tytgat B, Vyverman W, Willems A, Verleyen E (2018): Bacteria (16S) in Antarctic terrestrial soils of the Sor Rondane Mountains. v1.4. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_terrestrial_soils&v=1.4 https://doi.org/10.15468/ulq7je Contact: Tytgat, Bjorn Availability: ![]() Description Illumina sequencing data of bacterial communities in 52 soil samples from the western Sør Rondane Mountains (Dronning Maud Land, East Antarctica).The samples were taken along broad environmental gradients, including different types of bedrock, in an area covering nearly 1000 km2. more Geographic coverage: Sor Ronda Mountains, East Antarctica Taxonomic coverage: 16S ssh rRNA gene of Bacteria, using the primers pA (AGAGTTTGATCCTGGCTCAG, positions 8-27) and BKL1 (GTATTACCGCGGCTGCTGGCA, positions 536-516). Scope Themes: Biology > Organic (& bio-) chemistry Keywords: Terrestrial, Metadata, Sequencing, Soil, Antarctica, Bacteria Geographical coverage Antarctica [Marine Regions] Temporal coverage 1 January 2009 - 1 January 2010 Taxonomic coverage Bacteria [WoRMS] Parameter Molecular data Contributors Universiteit Gent (UGent), more, data creator Related datasets Dataset status: Completed Data type: Metadata Data origin: Research: field survey Metadatarecord created: 2018-12-04 Information last updated: 2019-04-10 |