Bacteria (16S ssu rRNA) in an Antarctic snow sampleCitationMichaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R (2019): Bacteria (16S ssu rRNA) in an Antarctic snow sample. v1.2. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow&v=1.2 https://doi.org/10.15468/lp7r84
DescriptionAmplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E). more Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used. Study Extent: Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E) Quality Control: Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions. Method step description: - Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt.
- 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose).
- Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water.
- PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry.
Scope Keywords: Terrestrial, Dna sequencing, Metadata, Snow, Antarctica, Bacteria
ContributorsUniversity of Messina , more, data creatorVrije Universiteit Brussel (VUB) , more, data creatorBelgian Nuclear Research Centre , more, data creatorItalian National Research Council (CNR) , more, data creator
Related datasetsPublished in: AntOBIS: Antarctic Ocean Biodiversity Information System, more (Partly) included in: RAS: Register of Antarctic Species, more
Dataset status: Completed Data type: Metadata Data origin: Research: field survey Metadatarecord created: 2019-03-28 Information last updated: 2019-04-10 All data in the Integrated Marine Information System (IMIS) is subject to the VLIZ privacy policy |